A novel acute part protein expressed in stage three grade C periodontitis

Leucine-rich alpha-2 glycoprotein (LRG): A novel acute part protein expressed in stage three grade C periodontitis earlier than and after periodontal remedy

Background: Leucine-rich alpha-2 glycoprotein (LRG) is a novel acute part protein concerned in inflammation-associated ailments and that thought of to be induced by a number of proinflammatory cytokines. This examine aimed to analyze gingival crevicular fluid (GCF) and serum ranges of LRG, interleukin (IL)-6 and tumor necrosis issue (TNF)-α in sufferers with stage three periodontitis earlier than and after non-surgical periodontal therapy.

Strategies: Twenty-five stage three periodontitis and twenty-five periodontally wholesome people had been enrolled within the examine. Medical periodontal measurements had been recorded; periodontitis sufferers acquired non-surgical periodontal therapy, and GCF and serum samples had been obtained at baseline and at 6 weeks after therapy. LRG, IL-6 and TNF-α had been decided by ELISA.

Outcomes: GCF and serum LRG, IL-6 and TNF-α had been considerably increased in periodontitis group than wholesome controls (P < 0.001). A major lower in GCF and serum LRG, IL-6 and TNF-α was detected after periodontal therapy in comparison with baseline values of periodontitis sufferers (P < 0.001).

Conclusion: Our findings revealed that LRG expression was elevated in stage three periodontitis each domestically and systemically, and non-surgical periodontal remedy was efficient in decreasing LRG ranges in GCF and serum of those sufferers. This text is protected by copyright. All rights reserved.

Protein Purification Applied sciences

Protein Biotechnology is an thrilling and fast- rising space of analysis, with quite a few industrial functions. The rising demand for creating environment friendly and speedy protein purification strategies is driving analysis and progress on this space. Advances and progress within the strategies and strategies of protein purification have been such that one can moderately count on that any protein of a given order of stability could also be purified to presently acceptable requirements of homogeneity.

Nevertheless, protein manufacturing price stays extraordinarily excessive, with downstream processing constituting a considerable proportion of the general price. Understanding of the strategies and optimization of the experimental situations have turn into crucial to the manufacturing business in an effort to decrease manufacturing prices whereas satisfying the standard in addition to all regulatory necessities. New purification processes exploiting particular, efficient and sturdy strategies and chromatographic supplies are anticipated to information the way forward for the protein purification market.

The position of native versus nonlocal physicochemical restraints in figuring out protein native construction

The tertiary construction of a local protein is dictated by the interaction of native secondary construction propensities, hydrogen bonding, and tertiary interactions. It’s argued that the area ofrecognized protein topologies covers all single area folds and outcomes from the compactness of the native construction and excluded quantity.

Protein compactness mixed with the chirality of the protein’s aspect chains additionally yields native-like Ramachandran plots. It’s the many-body, tertiary interactions amongst residues that collectively choose for the worldwide construction {that a} specific protein sequence adopts.

This explains why the latest advances in deep-learning approaches that predict protein side-chain contacts, the space matrix between residues, and sequence alignments are profitable. They succeed as a result of they implicitly discovered the many-body interactions amongst protein residues.

Total RNA from Human Tumor Tissue: Bladder
R1235010-10	Biochain	10 ug	EUR 351.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Mouse Normal Tissue: Bladder
R1334010-50	Biochain	50 ug	EUR 303.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Rat Normal Tissue: Bladder
R1434010-50	Biochain	50 ug	EUR 303.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Total PSA (t-PSA) ELISA Kit
PRB-5049-TOTAL-5	Cell Biolabs	5 x 96 assays	EUR 2283.00

Total RNA from Human Adult Normal Tissue: Bladder
R1234010-50	Biochain	50 ug	EUR 178.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Monkey (Rhesus) Normal Tissue: Bladder
R1534010-50	Biochain	50 ug	EUR 316.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Monkey (Cynomolgus) Normal Tissue: Bladder
R1534010-Cy	Biochain	50 ug	EUR 316.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Bovine Bladder cancer- associated protein, BLCAP ELISA KIT
ELI-33335b	Lifescience Market	96 Tests	EUR 928.00

BLCAP ELISA Kit\| Bovine Bladder cancer-associated protein ELISA
EF011166	Lifescience Market	96 Tests	EUR 689.00

Total RNA from Human Adult Normal Tissue 5 Donor Pool: Bladder
R1234010-P	Biochain	50 ug	EUR 328.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Horse TOTAL PROTEIN(TOTAL PROTEIN)
QY-E120081	Qayee Biotechnology	96T	EUR 478.00

Mouse Bladder PrimaCell2: Normal Bladder Fibroblasts
2-82007	CHI Scientific	1 Kit	Ask for price

Rat Bladder PrimaCell2: Normal Bladder Fibroblasts
2-82507	CHI Scientific	1 Kit	Ask for price

Human Bladder PrimaCell2: Normal Bladder Fibroblasts
2-96008	CHI Scientific	1 Kit	Ask for price

Bovine Ig(Total Immunoglobulin) ELISA Kit
EB0001	FN Test	96T	EUR 567.60
Detection range: 1.563-100 ug/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 0.938 ug/ml

Mouse Bladder PrimaCell1: Normal Bladder Epithelial Cells
2-82006	CHI Scientific	1 Kit	Ask for price

Rat Bladder PrimaCell1: Normal Bladder Epithelial Cells
2-82506	CHI Scientific	1 Kit	Ask for price

Human Bladder PrimaCell1: Normal Bladder Epithelial Cells
2-96007	CHI Scientific	1 Kit	Ask for price

Human Bladder PrimaCell3: Normal Bladder Smooth Muscle Cells
2-96009	CHI Scientific	1 Kit	Ask for price

Rat Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Medium
9-25007	CHI Scientific	5 x 100 ml	Ask for price

Mouse Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Medium
9-32007	CHI Scientific	5 x 100 ml	Ask for price

Human Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Medium
9-46008	CHI Scientific	5 x 100 ml	Ask for price

Bladder Cancer Exosome
P141-BL	101Bio	NULL	EUR NULL

Rat Bladder PrimaCell1: Normal Bladder Epithelial Cells Growth Medium
9-25006	CHI Scientific	5 x 100 ml	Ask for price

Mouse Bladder PrimaCell1: Normal Bladder Epithelial Cells Growth Medium
9-32006	CHI Scientific	5 x 100 ml	Ask for price

Human Bladder PrimaCell1: Normal Bladder Epithelial Cells Growth Medium
9-46007	CHI Scientific	5 x 100 ml	Ask for price

Human Bladder Tissue Preparation Buffer 2: Normal Bladder Fibroblasts
9-80008	CHI Scientific	1 x 100 ml	Ask for price

Mouse Bladder Tissue Preparation Buffer 2: Normal Bladder Fibroblasts
9-80121	CHI Scientific	1 x 100 ml	Ask for price

Rat Bladder Tissue Preparation Buffer 2: Normal Bladder Fibroblasts
9-80214	CHI Scientific	1 x 100 ml	Ask for price

Rat Total protein
QY-E11887	Qayee Biotechnology	96T	EUR 374.00

Bladder Cancer-Associated Protein (BLCAP) Antibody
20-abx119060	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	0 1 2 3
Shipped within 5-10 working days.

Bladder Cancer-Associated Protein (BLCAP) Antibody
20-abx326375	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Human Bladder PrimaCell3: Normal Bladder Smooth Muscle Cells Growth Medium
9-46009	CHI Scientific	5 x 100 ml	Ask for price

Human Bladder Tissue Preparation Buffer 1: Normal Bladder Epithelial Cells
9-80007	CHI Scientific	1 x 100 ml	Ask for price

Mouse Bladder Tissue Preparation Buffer 1: Normal Bladder Epithelial Cells
9-80120	CHI Scientific	1 x 100 ml	Ask for price

Rat Bladder Tissue Preparation Buffer 1: Normal Bladder Epithelial Cells
9-80213	CHI Scientific	1 x 100 ml	Ask for price

Human Bladder Tumor lysate
HTL-1325	Alpha Diagnostics	1 mg	EUR 773.00

Bladder Cancer Exosome RNA
P241-BL	101Bio	NULL	EUR NULL

Human Bladder Tissue Preparation Buffer 3: Normal Bladder Smooth Muscle Cells
9-80009	CHI Scientific	1 x 100 ml	Ask for price

Total Protein Extraction Kit
BSP003	BBI Biotech	50Preps	EUR 109.16
Product category: Molecular Biology Kits/Protein - Extraction/Animal

Total Protein Extraction Kit
K3011010	Biochain	1 kit	EUR 370.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total SulphonamidesⅠ
AT015	Unibiotest	1mg	EUR 607.00

Total Tetracyclines
AT052	Unibiotest	1mg	EUR 1114.00

Total QuinolonesⅠ
AT055	Unibiotest	1mg	EUR 945.00

Total aflatoxins
AT058	Unibiotest	1mg	EUR 1114.00

Total Acetochlors
AT094	Unibiotest	1mg	EUR 1114.00

Total Sudans
AT099	Unibiotest	1mg	EUR 1368.00

Total QuinolonesⅡ
AT124	Unibiotest	1mg	EUR 1114.00

Total SulphonamidesⅠ
AT221	Unibiotest	1mg	EUR 1114.00

Total Amantadines
AT240	Unibiotest	1mg	EUR 1368.00

Total Clarithromycins
AT245	Unibiotest	1mg	EUR 1368.00

Total aflatoxins
AG058	Unibiotest	1 mg	EUR 523.00

Total Tetracyclines
AG094	Unibiotest	1 mg	EUR 438.00

Total Sudans
AG099	Unibiotest	1 mg	EUR 523.00

Total Quinolones
AG124	Unibiotest	1 mg	EUR 523.00

Total SulphonamidesⅠ
AG221	Unibiotest	1 mg	EUR 523.00

Total Amantadines
AG240	Unibiotest	1 mg	EUR 523.00

Total Clarithromycins
AG245	Unibiotest	1 mg	EUR 523.00

Bladder Tumor Tissue Array - 12 cases of bladder tumor/adjacent normal pairs
Z7020105	Biochain	5 slides	EUR 1381.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Human Bladder Microvascular Endothelial Cells
HEC21	Neuromics	500,000 + Cells Cryoperserved	EUR 1080.00

Human Bladder Cancer Primer Library
HBLCP-I	Real Time Primers	1 set	EUR 548.00

Mouse Bladder Whole tissue lysate
MAL-1410	Alpha Diagnostics	1 mg	EUR 773.00

Rat Bladder Whole tissue lysate
RAL-1478	Alpha Diagnostics	1 mg	EUR 524.00

Human Bladder cancer associated protein(BLCAP) ELISA kit
E01B0803-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bladder cancer associated protein(BLCAP) ELISA kit
E01B0803-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bladder cancer associated protein(BLCAP) ELISA kit
E01B0803-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bladder cancer associated protein(BLCAP) ELISA kit
E03B0803-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bladder cancer associated protein(BLCAP) ELISA kit
E03B0803-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bladder cancer associated protein(BLCAP) ELISA kit
E03B0803-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bladder cancer associated protein(BLCAP) ELISA kit
E06B0803-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bladder cancer associated protein(BLCAP) ELISA kit
E06B0803-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bladder cancer associated protein(BLCAP) ELISA kit
E06B0803-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bladder cancer associated protein(BLCAP) ELISA kit
E04B0803-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bladder cancer associated protein(BLCAP) ELISA kit
E04B0803-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bladder cancer associated protein(BLCAP) ELISA kit
E04B0803-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bladder cancer associated protein(BLCAP) ELISA kit
E02B0803-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bladder cancer associated protein(BLCAP) ELISA kit
E02B0803-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bladder cancer associated protein(BLCAP) ELISA kit
E02B0803-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bladder cancer associated protein(BLCAP) ELISA kit
E08B0803-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bladder cancer associated protein(BLCAP) ELISA kit
E08B0803-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bladder cancer associated protein(BLCAP) ELISA kit
E08B0803-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bladder cancer associated protein(BLCAP) ELISA kit
E07B0803-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bladder cancer associated protein(BLCAP) ELISA kit
E07B0803-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bladder cancer associated protein(BLCAP) ELISA kit
E07B0803-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bladder cancer associated protein(BLCAP) ELISA kit
E09B0803-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bladder cancer associated protein(BLCAP) ELISA kit
E09B0803-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bladder cancer associated protein(BLCAP) ELISA kit
E09B0803-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bladder cancer- associated protein, BLCAP ELISA KIT
ELI-11024h	Lifescience Market	96 Tests	EUR 824.00

Rat Bladder Cancer-Associated Protein (BLCAP) ELISA Kit
abx391025-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Human Bladder Cancer-Associated Protein (BLCAP) ELISA Kit
abx384632-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Mouse Bladder Cancer-Associated Protein (BLCAP) ELISA Kit
abx388690-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Mouse Bladder cancer- associated protein, Blcap ELISA KIT
ELI-34704m	Lifescience Market	96 Tests	EUR 865.00

Membrane Protein from Human Adult Normal Tissue: Bladder
P3234010	Biochain	0.1 mg	EUR 285.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

AffiSelect Total Protein Extraction Solution
A0710-015	GenDepot	15X1ml	EUR 142.00

Rat Total Protein ELISA kit
E02T0089-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Total Protein ELISA kit
E02T0089-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Total Protein ELISA kit
E02T0089-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Total Protein ELISA kit
E04T0089-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Total Protein ELISA kit
E04T0089-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Total Protein ELISA kit
E04T0089-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Protein ELISA kit
E03T0089-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Protein ELISA kit
E03T0089-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Protein ELISA kit
E03T0089-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Protein ELISA kit
E01T0089-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Protein ELISA kit
E01T0089-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Protein ELISA kit
E01T0089-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mammalian Total Protein Extraction Kit
20-abx098853	Abbexa	EUR 356.00 EUR 105.00	0 1
Shipped within 5-10 working days.

Bacterial Total Protein Extraction Reagent
abx090632-50100assays	Abbexa	50-100 assays	EUR 258.00
Shipped within 5-10 working days.

Plant Total Protein Extraction Reagent
abx090633-50100assays	Abbexa	50-100 assays	EUR 230.00
Shipped within 5-10 working days.

Dog Total Protein ELISA kit
E08T0089-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Total Protein ELISA kit
E08T0089-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Total Protein ELISA kit
E08T0089-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Total Protein ELISA kit
E07T0089-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Total Protein ELISA kit
E07T0089-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Total Protein ELISA kit
E07T0089-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Total Protein ELISA kit
E09T0089-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Total Protein ELISA kit
E09T0089-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Total Protein ELISA kit
E09T0089-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Total Protein ELISA kit
E06T0089-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Total Protein ELISA kit
E06T0089-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Total Protein ELISA kit
E06T0089-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ExoMS Total Protein Capture Kit
EXOMS120A-8	SBI	8 reactions	EUR 477.00
Category: Exosomes

Total Protein from Lupus: Adrenal
P1236004Lup	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Appendix
P1236006Lup	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Arteriosclerosis: Aorta
P1236012Hd-4	Biochain	1 mg	EUR 804.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from hypertension: Artery
P1236013Hd-2	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from hypertension: Vein
P1236020Hd-2	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Colon
P1236090Lup	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from hypertension: Heart
P1236122Hd-2	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Heart
P1236122Lup	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Kidney
P1236142Lup	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Liver
P1236149Lup	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Asthma: Lung
P1236152Ld-1	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Bronchitis: Lung
P1236152Ld-2	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Emphysema: Lung
P1236152Ld-3	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Pneumonia: Lung
P1236152Ld-4	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Lung
P1236152Lup	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Ovary
P1236183Lup	Biochain	1 mg	EUR 723.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Pancreas
P1236188Lup	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Spleen
P1236246Lup	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Vagina
P1236283Lup	Biochain	1 mg	EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

QuantiChrom Total Protein Assay Kit
QTPR-01K	BioAssay Systems	1000	EUR 221.00
Description: For quantitative determination of total protein. Method: OD600nm (Pyrogallol Red). Samples: urine, cerebrospinal fluid etc. Species: all. Procedure: 10 min. Size: 1000 tests (96-well) and 200 tests (cuvette). Detection limit: 5 mg/dL.

QuantiChrom Total Protein Assay Kit
QTPR-100	BioAssay Systems	100	EUR 128.00
Description: For quantitative determination of total protein. Method: OD600nm (Pyrogallol Red). Samples: urine, cerebrospinal fluid etc. Species: all. Procedure: 10 min. Size: 1000 tests (96-well) and 200 tests (cuvette). Detection limit: 5 mg/dL.

Rabbit Total protein ELISA Kit
QY-E30303	Qayee Biotechnology	96T	EUR 374.00

Human Heat Shock Protein 90 total (Total HSP-90) ELISA Kit
abx257311-96tests	Abbexa	96 tests	EUR 637.00
Shipped within 5-12 working days.

Human Total HSP-90(Heat Shock Protein 90 total) ELISA Kit
EH4266	FN Test	96T	EUR 524.10
Detection range: 78.125-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Rat Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Supplements with Serum (for 500 ml medium)
9-26007	CHI Scientific	1 Set	Ask for price

Mouse Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Supplements with Serum (for 500 ml medium)
9-33007	CHI Scientific	1 Set	Ask for price

Human Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Supplements with Serum (for 500 ml medium)
9-47008	CHI Scientific	1 Set	Ask for price

Human Total Estrogen Receptor (Total ER) ELISA Kit
abx257928-96tests	Abbexa	96 tests	EUR 637.00
Shipped within 5-12 working days.

Human Cancer PrimaCell3: Bladder Tumor Cells
2-96026	CHI Scientific	1 Kit	Ask for price

Human Bladder OptiTDS1: Tissue Dissociation System
4-28007	CHI Scientific	1 Kit	Ask for price

IHP-PING-generating built-in human protein–protein interplay networks on-the-fly

Advances in high-throughput sequencing applied sciences have resulted in an exponential progress of publicly accessible organic datasets. Within the ‘large information’ pushed ‘post-genomic’ context, a lot work is being executed to discover human protein-protein interactions (PPIs) for a methods stage primarily based evaluation to uncover helpful indicators and acquire extra insights to advance present information and reply particular organic and well being questions.

These PPIs are experimentally or computationally predicted, saved in numerous on-line databases and a few of PPI assets are up to date commonly. As with many organic datasets, such common updates constantly render older PPI datasets doubtlessly outdated.

Furthermore, whereas many of those interactions are shared between these on-line assets, every useful resource contains its personal recognized PPIs and none of those databases exhaustively accommodates all current human PPI maps.

On this context, it’s important to allow the mixing of or combining interplay datasets from totally different assets, to generate a PPI map with elevated protection and confidence. To permit researchers to supply an built-in human PPI datasets in real-time, we introduce the built-in human protein-protein interplay community generator (IHP-PING) device.

IHP-PING is a versatile python package deal which generates a human PPI community from freely out there on-line assets. This device extracts and integrates heterogeneous PPI datasets to generate a unified PPI community, which is saved domestically for additional functions.

Stabilization of Proteins by Freeze-Drying within the Presence of Trehalose: A Case Research of Tubulin

Microtubules, polymers of the heterodimeric protein αβ-tubulin, are indispensable for a lot of mobile actions comparable to upkeep of cell form, division, migration, and ordered vesicle transport.

In vitro assays to examine microtubule capabilities and their regulation by related proteins require the supply of assembly-competent purified tubulin. Nevertheless, tubulin is a thermolabile protein that quickly converts right into a nonpolymerizing state.

Because of this, it’s often saved at -80 °C or liquid nitrogen to protect its conformation and polymerization properties. On this chapter, we describe a way for freeze-drying of assembly-competent tubulin within the presence of nonreducing sugar trehalose, and strategies enabling the analysis of tubulin capabilities in rehydrated samples.

Identification of a novel epitope particular for Gp85 protein of avian leukosis virus subgroup Ok

Through the previous 20 years, avian leukosis virus (ALV) induced large financial losses to poultry business in China. ALV-Ok as a newly discovered subgroup in recent times, which made the management and eradication of ALV tougher as they had been originated from the recombination of various subgroups.

Up to now, particular speedy detection strategies check with ALV-Ok are nonetheless lacking. Gp85 is the primary structural protein of the virus, which mediates the invasion of host cells by the virus and determinates the classification of subgroups. On this examine, we ready a monoclonal antibody (Mab) named Km3 in opposition to Gp85 of ALV-Ok. Immunoﬂuorescence assay confirmed that Km3 particularly acknowledged the strains of ALV-Ok reasonably than the strains of ALV-A or ALV-J.

To clarify the subgroups specificity of Km3, the epitope cognized by the Mab was identiﬁed by Western blotting utilizing 15 overlapping fragments spanning the Gp85. Lastly, the peptide ¹²⁹AFGPRSIDTLSDWSRPQ¹⁴⁵ was recognized because the minimal linear epitope acknowledged by Km3.

Alignment of Gp85 from totally different subgroups confirmed that the epitope was extremely conserved amongst ALV-Ok strains, which was fairly totally different from that of the strains from ALV -A, -B and -J. In conclusion, the Mab Km3 could function a helpful reagent for ALV-Ok detection and prognosis sooner or later.

PDXK antibody
70R-19200	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal PDXK antibody

PDXK antibody
39101-100ul	SAB	100ul	EUR 252.00

PDXK antibody
10R-5227	Fitzgerald	100 ul	EUR 726.00
Description: Mouse monoclonal PDXK antibody

PDXK antibody
10R-5228	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal PDXK antibody

PDXK Antibody
1-CSB-PA017748ESR2HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PDXK. Recognizes PDXK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PDXK Antibody
1-CSB-PA017748GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PDXK. Recognizes PDXK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PDXK antibody
70R-3565	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal PDXK antibody

PDXK antibody
70R-3757	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal PDXK antibody

PDXK siRNA
20-abx903928	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PDXK siRNA
20-abx928188	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PDXK siRNA
20-abx928189	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PDXK protein (His tag)
80R-1538	Fitzgerald	50 ug	EUR 457.00
Description: Purified recombinant Human PDXK protein

PDXK Recombinant Protein (Mouse)
RP161201	ABM	100 ug	Ask for price

PDXK Recombinant Protein (Rat)
RP219959	ABM	100 ug	Ask for price

Human Pyridoxal kinase (PDXK)
1-CSB-EP017748HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 62.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pyridoxal kinase(PDXK) expressed in E.coli

Human PDXK ELISA Kit
ELA-E1724h	Lifescience Market	96 Tests	EUR 824.00

Human PDXK ELISA Kit
EHP0639	Abclonal	96Tests	EUR 521.00

PDXK ELISA KIT\|Human
EF006014	Lifescience Market	96 Tests	EUR 689.00

Human PDXK shRNA Plasmid
20-abx955634	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

PDXK Pyridoxal Kinase Human Recombinant Protein
PROTO00764	BosterBio	Regular: 10ug	EUR 317.00
Description: PDXK Human Recombinant fused with a 24 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 336 amino acids (1-312 a.a.) and having a molecular mass of 37.6kDa. The PDXK is purified by proprietary chromatographic techniques.

PDXK Blocking Peptide
33R-7997	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDXK antibody, catalog no. 70R-3757

PDXK Blocking Peptide
33R-7204	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDXK antibody, catalog no. 70R-3565

PDXK Conjugated Antibody
C39101	SAB	100ul	EUR 397.00

PDXK cloning plasmid
CSB-CL017748HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 939 Sequence: atggaggaggagtgccgggtgctctccatacagagccacgtcatccgcggctacgtgggcaaccgggcggccacgttcccgctgcaggttttgggatttgagattgacgcggtgaactctgtccagttttcaaaccacacaggctatgcccactggaagggccaagtgctgaattc Show more
Description: A cloning plasmid for the PDXK gene.

PDXK cloning plasmid
CSB-CL017748HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 687 Sequence: atgtccccttccatctctgacccttgcctgggacaagctttgatggggggccccagcttcaaggctgtggtgggaacagcacccccaaatgccagcctctcctttcttcccatccaccagtatactgcggggccatttctggtctttgtccaacaggaaacccatttctggtggga Show more
Description: A cloning plasmid for the PDXK gene.

PDXK Rabbit pAb
A6687-100ul	Abclonal	100 ul	EUR 308.00

PDXK Rabbit pAb
A6687-200ul	Abclonal	200 ul	EUR 459.00

PDXK Rabbit pAb
A6687-20ul	Abclonal	20 ul	EUR 183.00

PDXK Rabbit pAb
A6687-50ul	Abclonal	50 ul	EUR 223.00

anti- PDXK antibody
FNab06294	FN Test	100µg	EUR 548.75
Immunogen: pyridoxal(pyridoxine, vitamin B6) kinase Uniprot ID: O00764 Gene ID: 8566 Research Area: Metabolism
Description: Antibody raised against PDXK

Anti-PDXK antibody
PAab06294	Lifescience Market	100 ug	EUR 386.00

Anti-PDXK antibody
STJ28770	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene phosphorylates vitamin B6, a step required for the conversion of vitamin B6 to pyridoxal-5-phosphate, an important cofactor in intermediary metabolism. The encoded protein is cytoplasmic and probably acts as a homodimer. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.

anti-PDXK.1
YF-PA15713	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to PDXK.1

anti-PDXK.1
YF-PA15714	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to PDXK.1

anti-PDXK.1
YF-PA15715	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to PDXK.1

anti-PDXK.1
YF-PA25133	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to PDXK.1

Rat Pyridoxal Kinase (PDXK) Protein
20-abx068798	Abbexa	EUR 773.00 EUR 300.00 EUR 2444.00 EUR 926.00 EUR 551.00	0 1 2 3 4
Shipped within 5-7 working days.

Mouse Pyridoxal Kinase (PDXK) Protein
20-abx068800	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	0 1 2 3 4
Shipped within 5-7 working days.

PDXK Protein Vector (Human) (pPB-C-His)
PV030681	ABM	500 ng	EUR 329.00

PDXK Protein Vector (Human) (pPB-N-His)
PV030682	ABM	500 ng	EUR 329.00

PDXK Protein Vector (Human) (pPM-C-HA)
PV030683	ABM	500 ng	EUR 329.00

PDXK Protein Vector (Human) (pPM-C-His)
PV030684	ABM	500 ng	EUR 329.00

PDXK Protein Vector (Human) (pPB-C-His)
PV030685	ABM	500 ng	EUR 329.00

PDXK Protein Vector (Human) (pPB-N-His)
PV030686	ABM	500 ng	EUR 329.00

PDXK Protein Vector (Human) (pPM-C-HA)
PV030687	ABM	500 ng	EUR 329.00

PDXK Protein Vector (Human) (pPM-C-His)
PV030688	ABM	500 ng	EUR 329.00

PDXK ORF Vector (Human) (pORF)
ORF007671	ABM	1.0 ug DNA	EUR 95.00

PDXK ORF Vector (Human) (pORF)
ORF007672	ABM	1.0 ug DNA	EUR 95.00

PDXK ELISA Kit (Human) (OKEH01237)
OKEH01237	Aviva Systems Biology	96 Wells	EUR 662.00
Description: Description of target: The protein encoded by this gene phosphorylates vitamin B6, a step required for the conversion of vitamin B6 to pyridoxal-5-phosphate, an important cofactor in intermediary metabolism. The encoded protein is cytoplasmic and probably acts as a homodimer. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Pyridoxal Kinase (PDXK) Antibody
20-abx005127	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Pyridoxal Kinase (PDXK) Antibody
20-abx101572	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	0 1 2 3 4
Shipped within 5-7 working days.

Pyridoxal Kinase (PDXK) Antibody
20-abx101573	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Pyridoxal Kinase (PDXK) Antibody
20-abx101574	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Bovine PDXK ELISA Kit
EBP0639	Abclonal	96Tests	EUR 521.00

Anserini PDXK ELISA Kit
EAP0639	Abclonal	96Tests	EUR 521.00

Chicken PDXK ELISA Kit
ECKP0639	Abclonal	96Tests	EUR 521.00

Canine PDXK ELISA Kit
ECP0639	Abclonal	96Tests	EUR 521.00

Goat PDXK ELISA Kit
EGTP0639	Abclonal	96Tests	EUR 521.00

Rat PDXK shRNA Plasmid
20-abx986804	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Pyridoxal Kinase (PDXK) Antibody
abx236294-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Pyridoxal Kinase (PDXK) Antibody
20-abx322378	Abbexa	EUR 439.00 EUR 328.00	0 1
Shipped within 5-10 working days.

Mouse PDXK shRNA Plasmid
20-abx980971	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Porcine PDXK ELISA Kit
EPP0639	Abclonal	96Tests	EUR 521.00

Sheep PDXK ELISA Kit
ESP0639	Abclonal	96Tests	EUR 521.00

Rat PDXK ELISA Kit
ERP0639	Abclonal	96Tests	EUR 521.00

Rabbit PDXK ELISA Kit
ERTP0639	Abclonal	96Tests	EUR 521.00

Monkey PDXK ELISA Kit
EMKP0639	Abclonal	96Tests	EUR 521.00

Mouse PDXK ELISA Kit
EMP0639	Abclonal	96Tests	EUR 521.00

Recombinant Pyridoxal Kinase (PDXK)
4-RPB724Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	0 1 2 3 4 5 6
Uniprot ID: O00764 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.0kDa Isoelectric Point: 6.2
Description: Recombinant Human Pyridoxal Kinase expressed in: E.coli

Recombinant Pyridoxal Kinase (PDXK)
4-RPB724Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	0 1 2 3 4 5 6
Uniprot ID: Q8K183 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.7kDa Isoelectric Point: 6.4
Description: Recombinant Mouse Pyridoxal Kinase expressed in: E.coli

Recombinant Pyridoxal Kinase (PDXK)
4-RPB724Ra01	Cloud-Clone	EUR 556.96 EUR 252.00 EUR 1813.60 EUR 671.20 EUR 1242.40 EUR 436.00 EUR 4384.00	0 1 2 3 4 5 6
Uniprot ID: O35331 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.2kDa Isoelectric Point: 6.5
Description: Recombinant Rat Pyridoxal Kinase expressed in: E.coli

Anti-PDXK.1 (4G6)
YF-MA16429	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to PDXK.1

Human Pyridoxal kinase(PDXK) ELISA kit
E01P0837-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pyridoxal kinase(PDXK) ELISA kit
E01P0837-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pyridoxal kinase(PDXK) ELISA kit
E01P0837-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pyridoxal Kinase (PDXK) ELISA Kit
abx251216-96tests	Abbexa	96 tests	EUR 754.00
Shipped within 5-12 working days.

Human PDXK/ Pyridoxal kinase ELISA Kit
E1900Hu	Sunlong	1 Kit	EUR 571.00

Human PDXK(Pyridoxal kinase) ELISA Kit
EH1899	FN Test	96T	EUR 567.60
Detection range: 0.312-20 ng/ml Uniprot ID: O00764 Alias: PDXK/Pyridoxal kinase/Pyridoxine kinase/PRED79/C21orf124/C21orf97/PKH/PNK/Vitamin B6 Kinase/HEL-S-1a
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Pyridoxal kinase, PDXK ELISA KIT
ELI-05591h	Lifescience Market	96 Tests	EUR 824.00

Human Pyridoxal Kinase (PDXK) ELISA Kit
abx518255-96tests	Abbexa	96 tests	EUR 754.00
Shipped within 5-12 working days.

PDXK sgRNA CRISPR Lentivector set (Human)
K1624201	ABM	3 x 1.0 ug	EUR 339.00

PDXK Protein Vector (Rat) (pPB-C-His)
PV293282	ABM	500 ng	EUR 603.00

PDXK Protein Vector (Rat) (pPB-N-His)
PV293283	ABM	500 ng	EUR 603.00

PDXK Protein Vector (Rat) (pPM-C-HA)
PV293284	ABM	500 ng	EUR 603.00

PDXK Protein Vector (Rat) (pPM-C-His)
PV293285	ABM	500 ng	EUR 603.00

PDXK Protein Vector (Mouse) (pPB-C-His)
PV214938	ABM	500 ng	EUR 603.00

PDXK Protein Vector (Mouse) (pPB-N-His)
PV214939	ABM	500 ng	EUR 603.00

PDXK Protein Vector (Mouse) (pPM-C-HA)
PV214940	ABM	500 ng	EUR 603.00

PDXK Protein Vector (Mouse) (pPM-C-His)
PV214941	ABM	500 ng	EUR 603.00

ELISA kit for Human PDXK (Pyridoxal Kinase)
E-EL-H1071	Elabscience Biotech	1 plate of 96 wells	EUR 534.00
Gentaur's PDXK ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PDXK. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PDXK (Pyridoxal Kinase) in samples from Serum, Plasma, Cell supernatant

PDXK sgRNA CRISPR Lentivector (Human) (Target 1)
K1624202	ABM	1.0 ug DNA	EUR 154.00

PDXK sgRNA CRISPR Lentivector (Human) (Target 2)
K1624203	ABM	1.0 ug DNA	EUR 154.00

PDXK sgRNA CRISPR Lentivector (Human) (Target 3)
K1624204	ABM	1.0 ug DNA	EUR 154.00

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse)
4-PAB724Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	0 1 2 3 4
Sequence of the immunogen: PDXK (Gln29~Lys253) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK)

Guinea Pig PDXK ELISA Kit
EGP0639	Abclonal	96Tests	EUR 521.00

Pdxk ORF Vector (Rat) (pORF)
ORF073321	ABM	1.0 ug DNA	EUR 506.00

Pdxk ORF Vector (Mouse) (pORF)
ORF053735	ABM	1.0 ug DNA	EUR 506.00

[One Step] PDXK Antibody Kit
RK05677	Abclonal	50 ul	EUR 240.00

PDXK ELISA Kit (Mouse) (OKEH05357)
OKEH05357	Aviva Systems Biology	96 Wells	EUR 662.00
Description: Description of target: Required for synthesis of pyridoxal-5-phosphate from vitamin B6.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.325 ng/mL

PDXK ELISA Kit (Rat) (OKEH06115)
OKEH06115	Aviva Systems Biology	96 Wells	EUR 662.00
Description: Description of target: Required for synthesis of pyridoxal-5-phosphate from vitamin B6.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.326 ng/mL

Recombinant Treponema Pallidum pdxK Protein (aa 1-269)
VAng-Cr1594-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 3876.00
Description: Treponema Pallidum (strain Nichols) putative pyridoxine kinase (pdxK), recombinant protein.

Recombinant Treponema Pallidum pdxK Protein (aa 1-269)
VAng-Cr1594-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2776.00
Description: Treponema Pallidum (strain Nichols) putative pyridoxine kinase (pdxK), recombinant protein.

Recombinant Treponema Pallidum pdxK Protein (aa 1-269)
VAng-Cr1594-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1887.00
Description: Treponema Pallidum (strain Nichols) putative pyridoxine kinase (pdxK), recombinant protein.

Recombinant Shigella Dysenteriae pdxK Protein (aa 1-283)
VAng-Lsx07494-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 3995.00
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Pyridoxine kinase, recombinant protein.

Recombinant Shigella Dysenteriae pdxK Protein (aa 1-283)
VAng-Lsx07494-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2828.00
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Pyridoxine kinase, recombinant protein.

Recombinant Shigella Dysenteriae pdxK Protein (aa 1-283)
VAng-Lsx07494-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1934.00
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Pyridoxine kinase, recombinant protein.

Recombinant Shigella Sonnei pdxK Protein (aa 1-283)
VAng-Lsx09983-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 4257.00
Description: Shigella Sonnei (strain Ss046) Pyridoxine kinase, recombinant protein.

Recombinant Shigella Sonnei pdxK Protein (aa 1-283)
VAng-Lsx09983-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2828.00
Description: Shigella Sonnei (strain Ss046) Pyridoxine kinase, recombinant protein.

Recombinant Shigella Sonnei pdxK Protein (aa 1-283)
VAng-Lsx09983-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1934.00
Description: Shigella Sonnei (strain Ss046) Pyridoxine kinase, recombinant protein.

Recombinant Bordetella Parapertussis pdxK Protein (aa 1-283)
VAng-Lsx4635-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 4192.00
Description: Bordetella Parapertussis Pyridoxine kinase, recombinant protein.

Recombinant Bordetella Parapertussis pdxK Protein (aa 1-283)
VAng-Lsx4635-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2835.00
Description: Bordetella Parapertussis Pyridoxine kinase, recombinant protein.

Recombinant Bordetella Parapertussis pdxK Protein (aa 1-283)
VAng-Lsx4635-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1934.00
Description: Bordetella Parapertussis Pyridoxine kinase, recombinant protein.

PDXK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV713253	ABM	1.0 ug DNA	EUR 316.00

PDXK Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV713257	ABM	1.0 ug DNA	EUR 316.00

PDXK Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV713258	ABM	1.0 ug DNA	EUR 316.00

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), APC
4-PAB724Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	0 1 2 3 4
Sequence of the immunogen: PDXK (Gln29~Lys253) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with APC.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAB724Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	0 1 2 3 4
Sequence of the immunogen: PDXK (Gln29~Lys253) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with Biotin.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), Cy3
4-PAB724Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	0 1 2 3 4
Sequence of the immunogen: PDXK (Gln29~Lys253) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with Cy3.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), FITC
4-PAB724Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	0 1 2 3 4
Sequence of the immunogen: PDXK (Gln29~Lys253) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with FITC.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), HRP
4-PAB724Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	0 1 2 3 4
Sequence of the immunogen: PDXK (Gln29~Lys253) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with HRP.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), PE
4-PAB724Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	0 1 2 3 4
Sequence of the immunogen: PDXK (Gln29~Lys253) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with PE.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse, Rat)
4-PAB724Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	0 1 2 3 4
Sequence of the immunogen: PDXK (Gln29~Ser285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Pyridoxal Kinase (PDXK)

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse, Rat)
4-PAB724Ra01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	0 1 2 3 4
Sequence of the immunogen: PDXK (Val35~Asn251) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Pyridoxal Kinase (PDXK)

Rabbit Pyridoxal kinase(PDXK) ELISA kit
E04P0837-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Pyridoxal kinase(PDXK) ELISA kit
E04P0837-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Pyridoxal kinase(PDXK) ELISA kit
E04P0837-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pyridoxal kinase(PDXK) ELISA kit
E02P0837-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pyridoxal kinase(PDXK) ELISA kit
E02P0837-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pyridoxal kinase(PDXK) ELISA kit
E02P0837-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pyridoxal kinase(PDXK) ELISA kit
E03P0837-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pyridoxal kinase(PDXK) ELISA kit
E03P0837-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pyridoxal kinase(PDXK) ELISA kit
E03P0837-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Pyridoxal kinase(PDXK) ELISA kit
E06P0837-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Pyridoxal kinase(PDXK) ELISA kit
E06P0837-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Pyridoxal kinase(PDXK) ELISA kit
E06P0837-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Pyridoxal kinase(PDXK) ELISA kit
E08P0837-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Pyridoxal kinase(PDXK) ELISA kit
E08P0837-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Pyridoxal kinase(PDXK) ELISA kit
E08P0837-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Pyridoxal kinase(PDXK) ELISA kit
E07P0837-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Pyridoxal kinase(PDXK) ELISA kit
E07P0837-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Pyridoxal kinase(PDXK) ELISA kit
E07P0837-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Pyridoxal kinase(PDXK) ELISA kit
E09P0837-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Pyridoxal kinase(PDXK) ELISA kit
E09P0837-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Pyridoxal kinase(PDXK) ELISA kit
E09P0837-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Pyridoxal kinase, PDXK ELISA KIT
ELI-05593b	Lifescience Market	96 Tests	EUR 928.00

Porcine Pyridoxal kinase, PDXK ELISA KIT
ELI-05594p	Lifescience Market	96 Tests	EUR 928.00

Leucine-rich alpha-2 glycoprotein (LRG): A novel acute part protein expressed in stage three grade C periodontitis earlier than and after periodontal remedy

Protein Purification Applied sciences

The position of native versus nonlocal physicochemical restraints in figuring out protein native construction

Total RNA from Human Tumor Tissue: Bladder

Total RNA from Mouse Normal Tissue: Bladder

Total RNA from Rat Normal Tissue: Bladder

Human Total PSA (t-PSA) ELISA Kit

Total RNA from Human Adult Normal Tissue: Bladder

Total RNA from Monkey (Rhesus) Normal Tissue: Bladder

Total RNA from Monkey (Cynomolgus) Normal Tissue: Bladder

Bovine Bladder cancer- associated protein, BLCAP ELISA KIT

BLCAP ELISA Kit| Bovine Bladder cancer-associated protein ELISA

Total RNA from Human Adult Normal Tissue 5 Donor Pool: Bladder

Horse TOTAL PROTEIN(TOTAL PROTEIN)

Mouse Bladder PrimaCell2: Normal Bladder Fibroblasts

Rat Bladder PrimaCell2: Normal Bladder Fibroblasts

Human Bladder PrimaCell2: Normal Bladder Fibroblasts

Bovine Ig(Total Immunoglobulin) ELISA Kit

Mouse Bladder PrimaCell1: Normal Bladder Epithelial Cells

Rat Bladder PrimaCell1: Normal Bladder Epithelial Cells

Human Bladder PrimaCell1: Normal Bladder Epithelial Cells

Human Bladder PrimaCell3: Normal Bladder Smooth Muscle Cells

Rat Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Medium

Mouse Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Medium

Human Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Medium

Bladder Cancer Exosome

Rat Bladder PrimaCell1: Normal Bladder Epithelial Cells Growth Medium

Mouse Bladder PrimaCell1: Normal Bladder Epithelial Cells Growth Medium

Human Bladder PrimaCell1: Normal Bladder Epithelial Cells Growth Medium

Human Bladder Tissue Preparation Buffer 2: Normal Bladder Fibroblasts

Mouse Bladder Tissue Preparation Buffer 2: Normal Bladder Fibroblasts

Rat Bladder Tissue Preparation Buffer 2: Normal Bladder Fibroblasts

Rat Total protein

Bladder Cancer-Associated Protein (BLCAP) Antibody

Bladder Cancer-Associated Protein (BLCAP) Antibody

Human Bladder PrimaCell3: Normal Bladder Smooth Muscle Cells Growth Medium

Human Bladder Tissue Preparation Buffer 1: Normal Bladder Epithelial Cells

Mouse Bladder Tissue Preparation Buffer 1: Normal Bladder Epithelial Cells

Rat Bladder Tissue Preparation Buffer 1: Normal Bladder Epithelial Cells

Human Bladder Tumor lysate

Bladder Cancer Exosome RNA

Human Bladder Tissue Preparation Buffer 3: Normal Bladder Smooth Muscle Cells

Total Protein Extraction Kit

Total Protein Extraction Kit

Total SulphonamidesⅠ

Total Tetracyclines

Total QuinolonesⅠ

Total aflatoxins

Total Acetochlors

Total Sudans

Total QuinolonesⅡ

Total SulphonamidesⅠ

Total Amantadines

Total Clarithromycins

Total aflatoxins

Total Tetracyclines

Total Sudans

Total Quinolones

Total SulphonamidesⅠ

Total Amantadines

Total Clarithromycins

Bladder Tumor Tissue Array - 12 cases of bladder tumor/adjacent normal pairs

Human Bladder Microvascular Endothelial Cells

Human Bladder Cancer Primer Library

Mouse Bladder Whole tissue lysate

Rat Bladder Whole tissue lysate

Human Bladder cancer associated protein(BLCAP) ELISA kit

Human Bladder cancer associated protein(BLCAP) ELISA kit

Human Bladder cancer associated protein(BLCAP) ELISA kit

Mouse Bladder cancer associated protein(BLCAP) ELISA kit

Mouse Bladder cancer associated protein(BLCAP) ELISA kit

Mouse Bladder cancer associated protein(BLCAP) ELISA kit

Goat Bladder cancer associated protein(BLCAP) ELISA kit

Goat Bladder cancer associated protein(BLCAP) ELISA kit

Goat Bladder cancer associated protein(BLCAP) ELISA kit

Rabbit Bladder cancer associated protein(BLCAP) ELISA kit

Rabbit Bladder cancer associated protein(BLCAP) ELISA kit

Rabbit Bladder cancer associated protein(BLCAP) ELISA kit

Rat Bladder cancer associated protein(BLCAP) ELISA kit

Rat Bladder cancer associated protein(BLCAP) ELISA kit