mousefunc

A novel acute part protein expressed in stage three grade C periodontitis

Leucine-rich alpha-2 glycoprotein (LRG): A novel acute part protein expressed in stage three grade C periodontitis earlier than and after periodontal remedy

Background: Leucine-rich alpha-2 glycoprotein (LRG) is a novel acute part protein concerned in inflammation-associated ailments and that thought of to be induced by a number of proinflammatory cytokines. This examine aimed to analyze gingival crevicular fluid (GCF) and serum ranges of LRG, interleukin (IL)-6 and tumor necrosis issue (TNF)-α in sufferers with stage three periodontitis earlier than and after non-surgical periodontal therapy.
Strategies: Twenty-five stage three periodontitis and twenty-five periodontally wholesome people had been enrolled within the examine. Medical periodontal measurements had been recorded; periodontitis sufferers acquired non-surgical periodontal therapy, and GCF and serum samples had been obtained at baseline and at 6 weeks after therapy. LRG, IL-6 and TNF-α had been decided by ELISA.
Outcomes: GCF and serum LRG, IL-6 and TNF-α had been considerably increased in periodontitis group than wholesome controls (P < 0.001). A major lower in GCF and serum LRG, IL-6 and TNF-α was detected after periodontal therapy in comparison with baseline values of periodontitis sufferers (P < 0.001).
Conclusion: Our findings revealed that LRG expression was elevated in stage three periodontitis each domestically and systemically, and non-surgical periodontal remedy was efficient in decreasing LRG ranges in GCF and serum of those sufferers. This text is protected by copyright. All rights reserved.

Protein Purification Applied sciences

Protein Biotechnology is an thrilling and fast- rising space of analysis, with quite a few industrial functions. The rising demand for creating environment friendly and speedy protein purification strategies is driving analysis and progress on this space. Advances and progress within the strategies and strategies of protein purification have been such that one can moderately count on that any protein of a given order of stability could also be purified to presently acceptable requirements of homogeneity.
Nevertheless, protein manufacturing price stays extraordinarily excessive, with downstream processing constituting a considerable proportion of the general price. Understanding of the strategies and optimization of the experimental situations have turn into crucial to the manufacturing business in an effort to decrease manufacturing prices whereas satisfying the standard in addition to all regulatory necessities. New purification processes exploiting particular, efficient and sturdy strategies and chromatographic supplies are anticipated to information the way forward for the protein purification market.

The position of native versus nonlocal physicochemical restraints in figuring out protein native construction

 

The tertiary construction of a local protein is dictated by the interaction of native secondary construction propensities, hydrogen bonding, and tertiary interactions. It’s argued that the area ofrecognized protein topologies covers all single area folds and outcomes from the compactness of the native construction and excluded quantity.
Protein compactness mixed with the chirality of the protein’s aspect chains additionally yields native-like Ramachandran plots. It’s the many-body, tertiary interactions amongst residues that collectively choose for the worldwide construction {that a} specific protein sequence adopts.
This explains why the latest advances in deep-learning approaches that predict protein side-chain contacts, the space matrix between residues, and sequence alignments are profitable. They succeed as a result of they implicitly discovered the many-body interactions amongst protein residues.
mousefunc
mousefunc

Total RNA from Human Tumor Tissue: Bladder

R1235010-10 10 ug
EUR 351.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Mouse Normal Tissue: Bladder

R1334010-50 50 ug
EUR 303.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Rat Normal Tissue: Bladder

R1434010-50 50 ug
EUR 303.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Total PSA (t-PSA) ELISA Kit

PRB-5049-TOTAL-5 5 x 96 assays
EUR 2283.00

Total RNA from Human Adult Normal Tissue: Bladder

R1234010-50 50 ug
EUR 178.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Monkey (Rhesus) Normal Tissue: Bladder

R1534010-50 50 ug
EUR 316.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Monkey (Cynomolgus) Normal Tissue: Bladder

R1534010-Cy 50 ug
EUR 316.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Bovine Bladder cancer- associated protein, BLCAP ELISA KIT

ELI-33335b 96 Tests
EUR 928.00

BLCAP ELISA Kit| Bovine Bladder cancer-associated protein ELISA

EF011166 96 Tests
EUR 689.00

Total RNA from Human Adult Normal Tissue 5 Donor Pool: Bladder

R1234010-P 50 ug
EUR 328.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Horse TOTAL PROTEIN(TOTAL PROTEIN)

QY-E120081 96T
EUR 478.00

Mouse Bladder PrimaCell2: Normal Bladder Fibroblasts

2-82007 1 Kit Ask for price

Rat Bladder PrimaCell2: Normal Bladder Fibroblasts

2-82507 1 Kit Ask for price

Human Bladder PrimaCell2: Normal Bladder Fibroblasts

2-96008 1 Kit Ask for price

Bovine Ig(Total Immunoglobulin) ELISA Kit

EB0001 96T
EUR 567.60
  • Detection range: 1.563-100 ug/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 0.938 ug/ml

Mouse Bladder PrimaCell1: Normal Bladder Epithelial Cells

2-82006 1 Kit Ask for price

Rat Bladder PrimaCell1: Normal Bladder Epithelial Cells

2-82506 1 Kit Ask for price

Human Bladder PrimaCell1: Normal Bladder Epithelial Cells

2-96007 1 Kit Ask for price

Human Bladder PrimaCell3: Normal Bladder Smooth Muscle Cells

2-96009 1 Kit Ask for price

Rat Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Medium

9-25007 5 x 100 ml Ask for price

Mouse Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Medium

9-32007 5 x 100 ml Ask for price

Human Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Medium

9-46008 5 x 100 ml Ask for price

Bladder Cancer Exosome

P141-BL NULL
EUR NULL

Rat Bladder PrimaCell1: Normal Bladder Epithelial Cells Growth Medium

9-25006 5 x 100 ml Ask for price

Mouse Bladder PrimaCell1: Normal Bladder Epithelial Cells Growth Medium

9-32006 5 x 100 ml Ask for price

Human Bladder PrimaCell1: Normal Bladder Epithelial Cells Growth Medium

9-46007 5 x 100 ml Ask for price

Human Bladder Tissue Preparation Buffer 2: Normal Bladder Fibroblasts

9-80008 1 x 100 ml Ask for price

Mouse Bladder Tissue Preparation Buffer 2: Normal Bladder Fibroblasts

9-80121 1 x 100 ml Ask for price

Rat Bladder Tissue Preparation Buffer 2: Normal Bladder Fibroblasts

9-80214 1 x 100 ml Ask for price

Rat Total protein

QY-E11887 96T
EUR 374.00

Bladder Cancer-Associated Protein (BLCAP) Antibody

20-abx119060
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Bladder Cancer-Associated Protein (BLCAP) Antibody

20-abx326375
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Human Bladder PrimaCell3: Normal Bladder Smooth Muscle Cells Growth Medium

9-46009 5 x 100 ml Ask for price

Human Bladder Tissue Preparation Buffer 1: Normal Bladder Epithelial Cells

9-80007 1 x 100 ml Ask for price

Mouse Bladder Tissue Preparation Buffer 1: Normal Bladder Epithelial Cells

9-80120 1 x 100 ml Ask for price

Rat Bladder Tissue Preparation Buffer 1: Normal Bladder Epithelial Cells

9-80213 1 x 100 ml Ask for price

Human Bladder Tumor lysate

HTL-1325 1 mg
EUR 773.00

Bladder Cancer Exosome RNA

P241-BL NULL
EUR NULL

Human Bladder Tissue Preparation Buffer 3: Normal Bladder Smooth Muscle Cells

9-80009 1 x 100 ml Ask for price

Total Protein Extraction Kit

BSP003 50Preps
EUR 109.16
  • Product category: Molecular Biology Kits/Protein - Extraction/Animal

Total Protein Extraction Kit

K3011010 1 kit
EUR 370.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total SulphonamidesⅠ

AT015 1mg
EUR 607.00

Total Tetracyclines

AT052 1mg
EUR 1114.00

Total QuinolonesⅠ

AT055 1mg
EUR 945.00

Total aflatoxins

AT058 1mg
EUR 1114.00

Total Acetochlors

AT094 1mg
EUR 1114.00

Total Sudans

AT099 1mg
EUR 1368.00

Total QuinolonesⅡ

AT124 1mg
EUR 1114.00

Total SulphonamidesⅠ

AT221 1mg
EUR 1114.00

Total Amantadines

AT240 1mg
EUR 1368.00

Total Clarithromycins

AT245 1mg
EUR 1368.00

Total aflatoxins

AG058 1 mg
EUR 523.00

Total Tetracyclines

AG094 1 mg
EUR 438.00

Total Sudans

AG099 1 mg
EUR 523.00

Total Quinolones

AG124 1 mg
EUR 523.00

Total SulphonamidesⅠ

AG221 1 mg
EUR 523.00

Total Amantadines

AG240 1 mg
EUR 523.00

Total Clarithromycins

AG245 1 mg
EUR 523.00

Bladder Tumor Tissue Array - 12 cases of bladder tumor/adjacent normal pairs

Z7020105 5 slides
EUR 1381.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Human Bladder Microvascular Endothelial Cells

HEC21 500,000 + Cells Cryoperserved
EUR 1080.00

Human Bladder Cancer Primer Library

HBLCP-I 1 set
EUR 548.00

Mouse Bladder Whole tissue lysate

MAL-1410 1 mg
EUR 773.00

Rat Bladder Whole tissue lysate

RAL-1478 1 mg
EUR 524.00

Human Bladder cancer associated protein(BLCAP) ELISA kit

E01B0803-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bladder cancer associated protein(BLCAP) ELISA kit

E01B0803-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bladder cancer associated protein(BLCAP) ELISA kit

E01B0803-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bladder cancer associated protein(BLCAP) ELISA kit

E03B0803-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bladder cancer associated protein(BLCAP) ELISA kit

E03B0803-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bladder cancer associated protein(BLCAP) ELISA kit

E03B0803-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bladder cancer associated protein(BLCAP) ELISA kit

E06B0803-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bladder cancer associated protein(BLCAP) ELISA kit

E06B0803-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bladder cancer associated protein(BLCAP) ELISA kit

E06B0803-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bladder cancer associated protein(BLCAP) ELISA kit

E04B0803-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bladder cancer associated protein(BLCAP) ELISA kit

E04B0803-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bladder cancer associated protein(BLCAP) ELISA kit

E04B0803-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bladder cancer associated protein(BLCAP) ELISA kit

E02B0803-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bladder cancer associated protein(BLCAP) ELISA kit

E02B0803-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bladder cancer associated protein(BLCAP) ELISA kit

E02B0803-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bladder cancer associated protein(BLCAP) ELISA kit

E08B0803-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bladder cancer associated protein(BLCAP) ELISA kit

E08B0803-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bladder cancer associated protein(BLCAP) ELISA kit

E08B0803-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bladder cancer associated protein(BLCAP) ELISA kit

E07B0803-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bladder cancer associated protein(BLCAP) ELISA kit

E07B0803-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bladder cancer associated protein(BLCAP) ELISA kit

E07B0803-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bladder cancer associated protein(BLCAP) ELISA kit

E09B0803-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bladder cancer associated protein(BLCAP) ELISA kit

E09B0803-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bladder cancer associated protein(BLCAP) ELISA kit

E09B0803-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bladder cancer associated protein(BLCAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bladder cancer- associated protein, BLCAP ELISA KIT

ELI-11024h 96 Tests
EUR 824.00

Rat Bladder Cancer-Associated Protein (BLCAP) ELISA Kit

abx391025-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Human Bladder Cancer-Associated Protein (BLCAP) ELISA Kit

abx384632-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse Bladder Cancer-Associated Protein (BLCAP) ELISA Kit

abx388690-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse Bladder cancer- associated protein, Blcap ELISA KIT

ELI-34704m 96 Tests
EUR 865.00

Membrane Protein from Human Adult Normal Tissue: Bladder

P3234010 0.1 mg
EUR 285.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

AffiSelect Total Protein Extraction Solution

A0710-015 15X1ml
EUR 142.00

Rat Total Protein ELISA kit

E02T0089-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Total Protein ELISA kit

E02T0089-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Total Protein ELISA kit

E02T0089-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Total Protein ELISA kit

E04T0089-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Total Protein ELISA kit

E04T0089-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Total Protein ELISA kit

E04T0089-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Protein ELISA kit

E03T0089-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Protein ELISA kit

E03T0089-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Protein ELISA kit

E03T0089-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Protein ELISA kit

E01T0089-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Protein ELISA kit

E01T0089-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Protein ELISA kit

E01T0089-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mammalian Total Protein Extraction Kit

20-abx098853
  • EUR 356.00
  • EUR 105.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Bacterial Total Protein Extraction Reagent

abx090632-50100assays 50-100 assays
EUR 258.00
  • Shipped within 5-10 working days.

Plant Total Protein Extraction Reagent

abx090633-50100assays 50-100 assays
EUR 230.00
  • Shipped within 5-10 working days.

Dog Total Protein ELISA kit

E08T0089-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Total Protein ELISA kit

E08T0089-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Total Protein ELISA kit

E08T0089-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Total Protein ELISA kit

E07T0089-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Total Protein ELISA kit

E07T0089-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Total Protein ELISA kit

E07T0089-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Total Protein ELISA kit

E09T0089-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Total Protein ELISA kit

E09T0089-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Total Protein ELISA kit

E09T0089-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Total Protein ELISA kit

E06T0089-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Total Protein ELISA kit

E06T0089-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Total Protein ELISA kit

E06T0089-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Total Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ExoMS Total Protein Capture Kit

EXOMS120A-8 8 reactions
EUR 477.00
  • Category: Exosomes

Total Protein from Lupus: Adrenal

P1236004Lup 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Appendix

P1236006Lup 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Arteriosclerosis: Aorta

P1236012Hd-4 1 mg
EUR 804.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from hypertension: Artery

P1236013Hd-2 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from hypertension: Vein

P1236020Hd-2 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Colon

P1236090Lup 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from hypertension: Heart

P1236122Hd-2 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Heart

P1236122Lup 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Kidney

P1236142Lup 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Liver

P1236149Lup 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Asthma: Lung

P1236152Ld-1 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Bronchitis: Lung

P1236152Ld-2 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Emphysema: Lung

P1236152Ld-3 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Pneumonia: Lung

P1236152Ld-4 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Lung

P1236152Lup 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Ovary

P1236183Lup 1 mg
EUR 723.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Pancreas

P1236188Lup 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Spleen

P1236246Lup 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Lupus: Vagina

P1236283Lup 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

QuantiChrom Total Protein Assay Kit

QTPR-01K 1000
EUR 221.00
Description: For quantitative determination of total protein. Method: OD600nm (Pyrogallol Red). Samples: urine, cerebrospinal fluid etc. Species: all. Procedure: 10 min. Size: 1000 tests (96-well) and 200 tests (cuvette). Detection limit: 5 mg/dL.

QuantiChrom Total Protein Assay Kit

QTPR-100 100
EUR 128.00
Description: For quantitative determination of total protein. Method: OD600nm (Pyrogallol Red). Samples: urine, cerebrospinal fluid etc. Species: all. Procedure: 10 min. Size: 1000 tests (96-well) and 200 tests (cuvette). Detection limit: 5 mg/dL.

Rabbit Total protein ELISA Kit

QY-E30303 96T
EUR 374.00

Human Heat Shock Protein 90 total (Total HSP-90) ELISA Kit

abx257311-96tests 96 tests
EUR 637.00
  • Shipped within 5-12 working days.

Human Total HSP-90(Heat Shock Protein 90 total) ELISA Kit

EH4266 96T
EUR 524.10
  • Detection range: 78.125-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Rat Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Supplements with Serum (for 500 ml medium)

9-26007 1 Set Ask for price

Mouse Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Supplements with Serum (for 500 ml medium)

9-33007 1 Set Ask for price

Human Bladder PrimaCell2: Normal Bladder Fibroblasts Growth Supplements with Serum (for 500 ml medium)

9-47008 1 Set Ask for price

Human Total Estrogen Receptor (Total ER) ELISA Kit

abx257928-96tests 96 tests
EUR 637.00
  • Shipped within 5-12 working days.

Human Cancer PrimaCell3: Bladder Tumor Cells

2-96026 1 Kit Ask for price

Human Bladder OptiTDS1: Tissue Dissociation System

4-28007 1 Kit Ask for price

IHP-PING-generating built-in human proteinprotein interplay networks on-the-fly

Advances in high-throughput sequencing applied sciences have resulted in an exponential progress of publicly accessible organic datasets. Within the ‘large information’ pushed ‘post-genomic’ context, a lot work is being executed to discover human protein-protein interactions (PPIs) for a methods stage primarily based evaluation to uncover helpful indicators and acquire extra insights to advance present information and reply particular organic and well being questions.
These PPIs are experimentally or computationally predicted, saved in numerous on-line databases and a few of PPI assets are up to date commonly. As with many organic datasets, such common updates constantly render older PPI datasets doubtlessly outdated.
Furthermore, whereas many of those interactions are shared between these on-line assets, every useful resource contains its personal recognized PPIs and none of those databases exhaustively accommodates all current human PPI maps.
On this context, it’s important to allow the mixing of or combining interplay datasets from totally different assets, to generate a PPI map with elevated protection and confidence. To permit researchers to supply an built-in human PPI datasets in real-time, we introduce the built-in human protein-protein interplay community generator (IHP-PING) device.
IHP-PING is a versatile python package deal which generates a human PPI community from freely out there on-line assets. This device extracts and integrates heterogeneous PPI datasets to generate a unified PPI community, which is saved domestically for additional functions.

Stabilization of Proteins by Freeze-Drying within the Presence of Trehalose: A Case Research of Tubulin

Microtubules, polymers of the heterodimeric protein αβ-tubulin, are indispensable for a lot of mobile actions comparable to upkeep of cell form, division, migration, and ordered vesicle transport.
In vitro assays to examine microtubule capabilities and their regulation by related proteins require the supply of assembly-competent purified tubulin. Nevertheless, tubulin is a thermolabile protein that quickly converts right into a nonpolymerizing state.
Because of this, it’s often saved at -80 °C or liquid nitrogen to protect its conformation and polymerization properties. On this chapter, we describe a way for freeze-drying of assembly-competent tubulin within the presence of nonreducing sugar trehalose, and strategies enabling the analysis of tubulin capabilities in rehydrated samples.

Identification of a novel epitope particular for Gp85 protein of avian leukosis virus subgroup Ok

Through the previous 20 years, avian leukosis virus (ALV) induced large financial losses to poultry business in China. ALV-Ok as a newly discovered subgroup in recent times, which made the management and eradication of ALV tougher as they had been originated from the recombination of various subgroups.
Up to now, particular speedy detection strategies check with ALV-Ok are nonetheless lacking. Gp85 is the primary structural protein of the virus, which mediates the invasion of host cells by the virus and determinates the classification of subgroups. On this examine, we ready a monoclonal antibody (Mab) named Km3 in opposition to Gp85 of ALV-Ok. Immunofluorescence assay confirmed that Km3 particularly acknowledged the strains of ALV-Ok reasonably than the strains of ALV-A or ALV-J.
To clarify the subgroups specificity of Km3, the epitope cognized by the Mab was identified by Western blotting utilizing 15 overlapping fragments spanning the Gp85. Lastly, the peptide 129AFGPRSIDTLSDWSRPQ145 was recognized because the minimal linear epitope acknowledged by Km3.
Alignment of Gp85 from totally different subgroups confirmed that the epitope was extremely conserved amongst ALV-Ok strains, which was fairly totally different from that of the strains from ALV -A, -B and -J. In conclusion, the Mab Km3 could function a helpful reagent for ALV-Ok detection and prognosis sooner or later.

PDXK antibody

70R-19200 50 ul
EUR 435.00
Description: Rabbit polyclonal PDXK antibody

PDXK antibody

39101-100ul 100ul
EUR 252.00

PDXK antibody

10R-5227 100 ul
EUR 726.00
Description: Mouse monoclonal PDXK antibody

PDXK antibody

10R-5228 100 ul
EUR 691.00
Description: Mouse monoclonal PDXK antibody

PDXK Antibody

1-CSB-PA017748ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PDXK. Recognizes PDXK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PDXK Antibody

1-CSB-PA017748GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PDXK. Recognizes PDXK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PDXK antibody

70R-3565 50 ug
EUR 467.00
Description: Rabbit polyclonal PDXK antibody

PDXK antibody

70R-3757 50 ug
EUR 467.00
Description: Rabbit polyclonal PDXK antibody

PDXK siRNA

20-abx903928
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PDXK siRNA

20-abx928188
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PDXK siRNA

20-abx928189
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PDXK protein (His tag)

80R-1538 50 ug
EUR 457.00
Description: Purified recombinant Human PDXK protein

PDXK Recombinant Protein (Mouse)

RP161201 100 ug Ask for price

PDXK Recombinant Protein (Rat)

RP219959 100 ug Ask for price

Human Pyridoxal kinase (PDXK)

1-CSB-EP017748HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 62.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pyridoxal kinase(PDXK) expressed in E.coli

Human PDXK ELISA Kit

ELA-E1724h 96 Tests
EUR 824.00

Human PDXK ELISA Kit

EHP0639 96Tests
EUR 521.00

PDXK ELISA KIT|Human

EF006014 96 Tests
EUR 689.00

Human PDXK shRNA Plasmid

20-abx955634
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PDXK Pyridoxal Kinase Human Recombinant Protein

PROTO00764 Regular: 10ug
EUR 317.00
Description: PDXK Human Recombinant fused with a 24 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 336 amino acids (1-312 a.a.) and having a molecular mass of 37.6kDa. The PDXK is purified by proprietary chromatographic techniques.

PDXK Blocking Peptide

33R-7997 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDXK antibody, catalog no. 70R-3757

PDXK Blocking Peptide

33R-7204 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDXK antibody, catalog no. 70R-3565

PDXK Conjugated Antibody

C39101 100ul
EUR 397.00

PDXK cloning plasmid

CSB-CL017748HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 939
  • Sequence: atggaggaggagtgccgggtgctctccatacagagccacgtcatccgcggctacgtgggcaaccgggcggccacgttcccgctgcaggttttgggatttgagattgacgcggtgaactctgtccagttttcaaaccacacaggctatgcccactggaagggccaagtgctgaattc
  • Show more
Description: A cloning plasmid for the PDXK gene.

PDXK cloning plasmid

CSB-CL017748HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 687
  • Sequence: atgtccccttccatctctgacccttgcctgggacaagctttgatggggggccccagcttcaaggctgtggtgggaacagcacccccaaatgccagcctctcctttcttcccatccaccagtatactgcggggccatttctggtctttgtccaacaggaaacccatttctggtggga
  • Show more
Description: A cloning plasmid for the PDXK gene.

PDXK Rabbit pAb

A6687-100ul 100 ul
EUR 308.00

PDXK Rabbit pAb

A6687-200ul 200 ul
EUR 459.00

PDXK Rabbit pAb

A6687-20ul 20 ul
EUR 183.00

PDXK Rabbit pAb

A6687-50ul 50 ul
EUR 223.00

anti- PDXK antibody

FNab06294 100µg
EUR 548.75
  • Immunogen: pyridoxal(pyridoxine, vitamin B6) kinase
  • Uniprot ID: O00764
  • Gene ID: 8566
  • Research Area: Metabolism
Description: Antibody raised against PDXK

Anti-PDXK antibody

PAab06294 100 ug
EUR 386.00

Anti-PDXK antibody

STJ28770 100 µl
EUR 277.00
Description: The protein encoded by this gene phosphorylates vitamin B6, a step required for the conversion of vitamin B6 to pyridoxal-5-phosphate, an important cofactor in intermediary metabolism. The encoded protein is cytoplasmic and probably acts as a homodimer. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.

anti-PDXK.1

YF-PA15713 50 ul
EUR 363.00
Description: Mouse polyclonal to PDXK.1

anti-PDXK.1

YF-PA15714 50 ug
EUR 363.00
Description: Mouse polyclonal to PDXK.1

anti-PDXK.1

YF-PA15715 100 ug
EUR 403.00
Description: Rabbit polyclonal to PDXK.1

anti-PDXK.1

YF-PA25133 50 ul
EUR 334.00
Description: Mouse polyclonal to PDXK.1

Rat Pyridoxal Kinase (PDXK) Protein

20-abx068798
  • EUR 773.00
  • EUR 300.00
  • EUR 2444.00
  • EUR 926.00
  • EUR 551.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Mouse Pyridoxal Kinase (PDXK) Protein

20-abx068800
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

PDXK Protein Vector (Human) (pPB-C-His)

PV030681 500 ng
EUR 329.00

PDXK Protein Vector (Human) (pPB-N-His)

PV030682 500 ng
EUR 329.00

PDXK Protein Vector (Human) (pPM-C-HA)

PV030683 500 ng
EUR 329.00

PDXK Protein Vector (Human) (pPM-C-His)

PV030684 500 ng
EUR 329.00

PDXK Protein Vector (Human) (pPB-C-His)

PV030685 500 ng
EUR 329.00

PDXK Protein Vector (Human) (pPB-N-His)

PV030686 500 ng
EUR 329.00

PDXK Protein Vector (Human) (pPM-C-HA)

PV030687 500 ng
EUR 329.00

PDXK Protein Vector (Human) (pPM-C-His)

PV030688 500 ng
EUR 329.00

PDXK ORF Vector (Human) (pORF)

ORF007671 1.0 ug DNA
EUR 95.00

PDXK ORF Vector (Human) (pORF)

ORF007672 1.0 ug DNA
EUR 95.00

PDXK ELISA Kit (Human) (OKEH01237)

OKEH01237 96 Wells
EUR 662.00
Description: Description of target: The protein encoded by this gene phosphorylates vitamin B6, a step required for the conversion of vitamin B6 to pyridoxal-5-phosphate, an important cofactor in intermediary metabolism. The encoded protein is cytoplasmic and probably acts as a homodimer. Alternatively spliced transcript variants have been described, but their biological validity has not been determined.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Pyridoxal Kinase (PDXK) Antibody

20-abx005127
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Pyridoxal Kinase (PDXK) Antibody

20-abx101572
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Pyridoxal Kinase (PDXK) Antibody

20-abx101573
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Pyridoxal Kinase (PDXK) Antibody

20-abx101574
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Bovine PDXK ELISA Kit

EBP0639 96Tests
EUR 521.00

Anserini PDXK ELISA Kit

EAP0639 96Tests
EUR 521.00

Chicken PDXK ELISA Kit

ECKP0639 96Tests
EUR 521.00

Canine PDXK ELISA Kit

ECP0639 96Tests
EUR 521.00

Goat PDXK ELISA Kit

EGTP0639 96Tests
EUR 521.00

Rat PDXK shRNA Plasmid

20-abx986804
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Pyridoxal Kinase (PDXK) Antibody

abx236294-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Pyridoxal Kinase (PDXK) Antibody

20-abx322378
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Mouse PDXK shRNA Plasmid

20-abx980971
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Porcine PDXK ELISA Kit

EPP0639 96Tests
EUR 521.00

Sheep PDXK ELISA Kit

ESP0639 96Tests
EUR 521.00

Rat PDXK ELISA Kit

ERP0639 96Tests
EUR 521.00

Rabbit PDXK ELISA Kit

ERTP0639 96Tests
EUR 521.00

Monkey PDXK ELISA Kit

EMKP0639 96Tests
EUR 521.00

Mouse PDXK ELISA Kit

EMP0639 96Tests
EUR 521.00

Recombinant Pyridoxal Kinase (PDXK)

4-RPB724Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: O00764
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.0kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Pyridoxal Kinase expressed in: E.coli

Recombinant Pyridoxal Kinase (PDXK)

4-RPB724Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q8K183
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.7kDa
  • Isoelectric Point: 6.4
Description: Recombinant Mouse Pyridoxal Kinase expressed in: E.coli

Recombinant Pyridoxal Kinase (PDXK)

4-RPB724Ra01
  • EUR 556.96
  • EUR 252.00
  • EUR 1813.60
  • EUR 671.20
  • EUR 1242.40
  • EUR 436.00
  • EUR 4384.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: O35331
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.2kDa
  • Isoelectric Point: 6.5
Description: Recombinant Rat Pyridoxal Kinase expressed in: E.coli

Anti-PDXK.1 (4G6)

YF-MA16429 100 ug
EUR 363.00
Description: Mouse monoclonal to PDXK.1

Human Pyridoxal kinase(PDXK) ELISA kit

E01P0837-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pyridoxal kinase(PDXK) ELISA kit

E01P0837-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pyridoxal kinase(PDXK) ELISA kit

E01P0837-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pyridoxal Kinase (PDXK) ELISA Kit

abx251216-96tests 96 tests
EUR 754.00
  • Shipped within 5-12 working days.

Human PDXK/ Pyridoxal kinase ELISA Kit

E1900Hu 1 Kit
EUR 571.00

Human PDXK(Pyridoxal kinase) ELISA Kit

EH1899 96T
EUR 567.60
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: O00764
  • Alias: PDXK/Pyridoxal kinase/Pyridoxine kinase/PRED79/C21orf124/C21orf97/PKH/PNK/Vitamin B6 Kinase/HEL-S-1a
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Pyridoxal kinase, PDXK ELISA KIT

ELI-05591h 96 Tests
EUR 824.00

Human Pyridoxal Kinase (PDXK) ELISA Kit

abx518255-96tests 96 tests
EUR 754.00
  • Shipped within 5-12 working days.

PDXK sgRNA CRISPR Lentivector set (Human)

K1624201 3 x 1.0 ug
EUR 339.00

PDXK Protein Vector (Rat) (pPB-C-His)

PV293282 500 ng
EUR 603.00

PDXK Protein Vector (Rat) (pPB-N-His)

PV293283 500 ng
EUR 603.00

PDXK Protein Vector (Rat) (pPM-C-HA)

PV293284 500 ng
EUR 603.00

PDXK Protein Vector (Rat) (pPM-C-His)

PV293285 500 ng
EUR 603.00

PDXK Protein Vector (Mouse) (pPB-C-His)

PV214938 500 ng
EUR 603.00

PDXK Protein Vector (Mouse) (pPB-N-His)

PV214939 500 ng
EUR 603.00

PDXK Protein Vector (Mouse) (pPM-C-HA)

PV214940 500 ng
EUR 603.00

PDXK Protein Vector (Mouse) (pPM-C-His)

PV214941 500 ng
EUR 603.00

ELISA kit for Human PDXK (Pyridoxal Kinase)

E-EL-H1071 1 plate of 96 wells
EUR 534.00
  • Gentaur's PDXK ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PDXK. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PDXK (Pyridoxal Kinase) in samples from Serum, Plasma, Cell supernatant

PDXK sgRNA CRISPR Lentivector (Human) (Target 1)

K1624202 1.0 ug DNA
EUR 154.00

PDXK sgRNA CRISPR Lentivector (Human) (Target 2)

K1624203 1.0 ug DNA
EUR 154.00

PDXK sgRNA CRISPR Lentivector (Human) (Target 3)

K1624204 1.0 ug DNA
EUR 154.00

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse)

4-PAB724Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: PDXK (Gln29~Lys253)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK)

Guinea Pig PDXK ELISA Kit

EGP0639 96Tests
EUR 521.00

Pdxk ORF Vector (Rat) (pORF)

ORF073321 1.0 ug DNA
EUR 506.00

Pdxk ORF Vector (Mouse) (pORF)

ORF053735 1.0 ug DNA
EUR 506.00

[One Step] PDXK Antibody Kit

RK05677 50 ul
EUR 240.00

PDXK ELISA Kit (Mouse) (OKEH05357)

OKEH05357 96 Wells
EUR 662.00
Description: Description of target: Required for synthesis of pyridoxal-5-phosphate from vitamin B6.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.325 ng/mL

PDXK ELISA Kit (Rat) (OKEH06115)

OKEH06115 96 Wells
EUR 662.00
Description: Description of target: Required for synthesis of pyridoxal-5-phosphate from vitamin B6.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.326 ng/mL

Recombinant Treponema Pallidum pdxK Protein (aa 1-269)

VAng-Cr1594-1mgEcoli 1 mg (E. coli)
EUR 3876.00
Description: Treponema Pallidum (strain Nichols) putative pyridoxine kinase (pdxK), recombinant protein.

Recombinant Treponema Pallidum pdxK Protein (aa 1-269)

VAng-Cr1594-500gEcoli 500 µg (E. coli)
EUR 2776.00
Description: Treponema Pallidum (strain Nichols) putative pyridoxine kinase (pdxK), recombinant protein.

Recombinant Treponema Pallidum pdxK Protein (aa 1-269)

VAng-Cr1594-50gEcoli 50 µg (E. coli)
EUR 1887.00
Description: Treponema Pallidum (strain Nichols) putative pyridoxine kinase (pdxK), recombinant protein.

Recombinant Shigella Dysenteriae pdxK Protein (aa 1-283)

VAng-Lsx07494-1mgEcoli 1 mg (E. coli)
EUR 3995.00
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Pyridoxine kinase, recombinant protein.

Recombinant Shigella Dysenteriae pdxK Protein (aa 1-283)

VAng-Lsx07494-500gEcoli 500 µg (E. coli)
EUR 2828.00
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Pyridoxine kinase, recombinant protein.

Recombinant Shigella Dysenteriae pdxK Protein (aa 1-283)

VAng-Lsx07494-50gEcoli 50 µg (E. coli)
EUR 1934.00
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Pyridoxine kinase, recombinant protein.

Recombinant Shigella Sonnei pdxK Protein (aa 1-283)

VAng-Lsx09983-1mgEcoli 1 mg (E. coli)
EUR 4257.00
Description: Shigella Sonnei (strain Ss046) Pyridoxine kinase, recombinant protein.

Recombinant Shigella Sonnei pdxK Protein (aa 1-283)

VAng-Lsx09983-500gEcoli 500 µg (E. coli)
EUR 2828.00
Description: Shigella Sonnei (strain Ss046) Pyridoxine kinase, recombinant protein.

Recombinant Shigella Sonnei pdxK Protein (aa 1-283)

VAng-Lsx09983-50gEcoli 50 µg (E. coli)
EUR 1934.00
Description: Shigella Sonnei (strain Ss046) Pyridoxine kinase, recombinant protein.

Recombinant Bordetella Parapertussis pdxK Protein (aa 1-283)

VAng-Lsx4635-1mgEcoli 1 mg (E. coli)
EUR 4192.00
Description: Bordetella Parapertussis Pyridoxine kinase, recombinant protein.

Recombinant Bordetella Parapertussis pdxK Protein (aa 1-283)

VAng-Lsx4635-500gEcoli 500 µg (E. coli)
EUR 2835.00
Description: Bordetella Parapertussis Pyridoxine kinase, recombinant protein.

Recombinant Bordetella Parapertussis pdxK Protein (aa 1-283)

VAng-Lsx4635-50gEcoli 50 µg (E. coli)
EUR 1934.00
Description: Bordetella Parapertussis Pyridoxine kinase, recombinant protein.

PDXK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV713253 1.0 ug DNA
EUR 316.00

PDXK Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV713257 1.0 ug DNA
EUR 316.00

PDXK Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV713258 1.0 ug DNA
EUR 316.00

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), APC

4-PAB724Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: PDXK (Gln29~Lys253)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with APC.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAB724Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: PDXK (Gln29~Lys253)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with Biotin.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), Cy3

4-PAB724Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: PDXK (Gln29~Lys253)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with Cy3.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), FITC

4-PAB724Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: PDXK (Gln29~Lys253)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with FITC.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), HRP

4-PAB724Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: PDXK (Gln29~Lys253)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with HRP.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse), PE

4-PAB724Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: PDXK (Gln29~Lys253)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Pyridoxal Kinase (PDXK). This antibody is labeled with PE.

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse, Rat)

4-PAB724Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: PDXK (Gln29~Ser285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Pyridoxal Kinase (PDXK)

Pyridoxal Kinase (PDXK) Polyclonal Antibody (Human, Mouse, Rat)

4-PAB724Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: PDXK (Val35~Asn251)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Pyridoxal Kinase (PDXK)

Rabbit Pyridoxal kinase(PDXK) ELISA kit

E04P0837-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Pyridoxal kinase(PDXK) ELISA kit

E04P0837-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Pyridoxal kinase(PDXK) ELISA kit

E04P0837-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pyridoxal kinase(PDXK) ELISA kit

E02P0837-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pyridoxal kinase(PDXK) ELISA kit

E02P0837-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pyridoxal kinase(PDXK) ELISA kit

E02P0837-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pyridoxal kinase(PDXK) ELISA kit

E03P0837-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pyridoxal kinase(PDXK) ELISA kit

E03P0837-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pyridoxal kinase(PDXK) ELISA kit

E03P0837-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Pyridoxal kinase(PDXK) ELISA kit

E06P0837-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Pyridoxal kinase(PDXK) ELISA kit

E06P0837-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Pyridoxal kinase(PDXK) ELISA kit

E06P0837-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Pyridoxal kinase(PDXK) ELISA kit

E08P0837-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Pyridoxal kinase(PDXK) ELISA kit

E08P0837-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Pyridoxal kinase(PDXK) ELISA kit

E08P0837-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Pyridoxal kinase(PDXK) ELISA kit

E07P0837-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Pyridoxal kinase(PDXK) ELISA kit

E07P0837-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Pyridoxal kinase(PDXK) ELISA kit

E07P0837-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Pyridoxal kinase(PDXK) ELISA kit

E09P0837-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Pyridoxal kinase(PDXK) ELISA kit

E09P0837-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Pyridoxal kinase(PDXK) ELISA kit

E09P0837-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Pyridoxal kinase(PDXK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Pyridoxal kinase, PDXK ELISA KIT

ELI-05593b 96 Tests
EUR 928.00

Porcine Pyridoxal kinase, PDXK ELISA KIT

ELI-05594p 96 Tests
EUR 928.00

Leave a Reply

Your email address will not be published. Required fields are marked *